The Association Between the STAT1 g.3141C>T Polymorphism and Reproductive Performance in Highyielding Holstein-Friesian Dairy Cows


Aldevir Ö., Güçlü Ş., Ak S. D. , Gümen A., Ardıçlı S.

TURKISH SOCIETY OF VETERINARY GYNECOLOGY CONGRESS OF 9th NATIONAL & 3rd INTERNATIONAL, Antalya, Turkey, 24 - 27 March 2022, no.33, pp.194-195

  • Publication Type: Conference Paper / Summary Text
  • City: Antalya
  • Country: Turkey
  • Page Numbers: pp.194-195

Abstract

Süt sığırcılığında, süt verimi odaklı seleksiyon programları verim artışında önemli ilerlemelerin elde edilmesini

sağlamıştır. Ancak, hastalıklara direnç ve özellikle de reprodüktif özelliklerde ciddi problemlerin ortaya çıkmasına

da neden olmuştur. Bu bağlamda, süt sığırlarında en önemli fenotipik özelliklerden biri reprodüktif performanstır.

Bu nedenle, bu çalışmada sığır STAT1 geni (GenBank Acc. No: AW289395) g.3141C>T polimorfizminin Holstein-

Friesian ineklerde reprodüktif özellikler üzerindeki etkilerinin değerlendirilmesi amaçlanmıştır. Tüm hayvanlar

aynı besleme ve yönetim prosedürlerine tabi tutulmuştur. Süt verimi, sürü yönetim programı ile kayıt altına

alınmıştır ve 305 günlük süt verimi hesaplanmıştır. Bu çalışmada analiz edilen fenotipik özellikler, toplam süt

verimi, 305 günlük süt verimi, açık gün sayısı ve tohumlama sayısıdır. İstatistiksel modellerde, aynı zamanda sürü

dışı oranları, vücut kondisyon skorları ve mevsim de değerlendirilmiştir. Başlangıçta, tüm inekler, bireysel süt

verimi kayıtlarına (%80) dayalı bir seleksiyon indeksi ile sıralanmıştır. İlk tohumlamada gebe kalan ve gebelik

başına 3 den fazla tohumlaması bulunan toplam 75 inek seçilerek 3'UTR'de bulunan STAT1 markörü için PCRRFLP

yöntemi ile genotiplendirilmiştir. PCR prosedüründe F: 5'GCCTCAAGTTTGCCAGTGGC3' ve R:

5'GGCTCCCTTGATAGAACTGT3' primerleri kullanılmıştır. Amplifiye edilen ürün (314 bp), BspHI ile enzim

kesimine ve daha sonra agaroz jel elektroforezine tabi tutulmuştur. Genotip-fenotip ilişkilendirme analizi, Minitab

yazılımının genel doğrusal model (GLM) prosedüründe, en küçük kareler yöntemiyle gerçekleştirilmiştir. Post-hoc

karşılaştırma olarak Tukey testi kullanılmıştır. Sürü dışı oranları ile genotipler arasındaki ilişki Pearson'ın Ki-kare

testi ile değerlendirilmiştir. Heterozigotluk (He), homozigotluk (Ho), etkili alel sayısı (Ne) ve polimorfizm bilgi

içeriği (PIC) dahil olmak üzere popülasyon genetiği parametreleri değerlendirilmiş ve Hardy-Weinberg

Dengesinden (HWE) sapma test edilmiştir. Sonuçlar, g.3141C>T polimorfizminin kabul edilebilir populasyon

parametrelerine (Ne=1.9231; He=0.48) sahip olduğunu, bu markörün seçilen populasyon için orta derecede

bilgilendirici olduğunu (PIC=0.3648) ve HWE'den bir sapma olduğunu (χ2=14.82; P<0.001) ortaya koydu.

GLM'de STAT1 ile tohumlama sayısı arasındaki ilişki istatistiksel olarak anlamlı bulunmuştur (P<0.05). TT

genotipi taşıyan hayvanlar, en yüksek ortalama tohumlama sayısı (3.71±0.74) ile karakterizedir. Bu kritik bir

sonuçtur çünkü STAT1 g.3141C>T polimorfizmi, süt verimine olan etkilerinden dolayı birçok SNP-paneli veya

SNP-çipte yer almaktadır. Bildiğimiz kadarıyla, bu çalışma, STAT1’in gebe kalma başına tohumlama sayısı

üzerinde potansiyel bir olumsuz etkisinin olduğunu ilk kez göstermiştir. TT genotipinin %26,67'lik bir frekansa

sahip olduğu göz önüne alındığında, bu ilişkinin göz ardı edilmesi sürü bazında önemli bir reprodüktif performans

düşüşüne yol açabilir. Ayrıca, STAT1 ve sürü dışı oranları arasında anlamlı bir ilişkinin olduğu görülmüştür

(P<0.01). STAT1 ile analiz edilen diğer özellikler arasında herhangi ilişki bulunmamıştır. Bu çalışma, STAT1 geni

ile ilgili yeni önemli noktaları göstermektedir. Sonuç olarak, süt sığırlarında reprodüktif performansın genotipik

olarak değerlendirilmesine katkıda bulunabilir.